3.1 Session 3. Application of natural products in human and ani

Transkrypt

Session 3. Application of natural products in human and animal nutrition, pharmacy and cosmetic industries
3.1
Teas that heal and teas that kill
Alicja M. Zobel1, Piotr Suchocki2,
and Mieczysław Kuraś3
1Department
of Chemistry, Trent University, Petrborough,
ON, Canada; 2Department of Pharmaceutical Chemistry,
National Medicines Institute, 00-725 Warsaw, Poland;
3Department of Biology, Warsaw University, 02-097 Warsaw,
Poland
e-mail: Alicja Zobel <[email protected]>
I finished my Master’s degree and PhD under the supervision of Prof. Jósef Szuleta and Dr. Podbielkowska.
Prof. Szuleta worked on Sambucus nigra (elder-berry), in
which there were long cells with what were then called
tannins – proantho-cyanidins – of which epicatechin and
gallocatechin are major phenolics in green tea, known
for its antioxidant properties. My scientific research involved eight Sambucus species grown in the botanical
garden in Warsaw and provided by Teresa Bielska, MSc.
In the very long tannin cells, up to 32 cm and as long as
the internodes themselves, there were many nuclei that
divided synchronically; thus my supposition was that if
teas made from such green leaves and shoots of elderberry have anti-cancer properties these had to be attributed to mechanisms other than inhibition of cell division.
My own Master’s degree students (Majewska, Gadzała)
worked on different Sambucus species and discovered the
mechanism of reaction to be influencing mitochondria, increasing absorption of oxygen and giving these cells more
energy. With Profs. Mieczysław Kuraś and Teleżynski as
well as Dr. Czubay we evaluated the modes of action using electron microscopes in the Botany and Zoology Institutes. With Dr. Podbielkowska and Maria Wałęza, MSc
we worked on inhibition of mitoses of Allium promeristems and inhibition of oxygen absorption with lowered
ATP production; thus less energy was available. The compounds of interest to us were clinically used drugs: methotrexate, dacarbazene, cisplatin and fluorouracil, which
caused dangerous chromosomal aberrations, and thus
could possibly lead to secondary cancers. In contrast, the
green parts of elderberry, and epicatechin and gallocatechin, did not cause aberrations. I became interested in the
natural teas used in different parts of the globe at different elevations above sea level, e.g., in Nepal where, over
only an 80 km distance, Taxus wallichiana teas are grown
from 300 to 6000 metres, with a great difference in temperature and intensity of ultraviolet radiation. Then one
important day, some time before defense of my doctoral
disser-tation, and thus before 1979, Father Szeliga came
to my professor (they were both priests) and was talking
about an Uncaria remedy and three others, of which no
one in Poland had yet heard. He had heard about these
from a Shaman in Peru, where he later founded a hospital with the help of two doctors and Maria Kralewska.
As a result I took a vacation, went to Peru, and collected
the leaves pointed out to me by the Shaman on a 300 metre-long liana hanging from high in the trees. The results
were very interesting, and led my friends to look for other
teas. I immigrated to Canada in 1986 just after the Chernobyl disaster, and later, when I had a program on Trent
Radio on Nature and Health an older man asked me if
I had investigated the Ojibway “Essiac” the mixture of
five herbs used by nurse Caisse (the name is the reversal
of hers), who was very respected by local First Nations
women who had told her about this remedy. I said no, but
I would investigate Essiac with the aid of Trent University
students. And it changed my point of view when two of
my students, Angela Keitley and Julia Smith, came from
the oncology laboratory at Queen’s University and shouted, “It does not kill cancer cells, it stimulates them!” So
I immediately got the idea, what about human immune
cells, and what a disco-very it was, as Essiac stimulated
our white cells twice as much as cancer; thus we could
fight and inhibit cancer naturally. It was wonderful that
experiments on human breast cancer over thousands of
years, starting with witch doctors, had led to development of a natural product tea for its treatment. The new
idea of a natural products section was introduced in 1999
at the Princess Margaret Hospital Cancer Congress. My
scientific group and a few phytochemists showed that
secondary plant metabolites in plant extracts were potential anticancer agents because immune cells were stimulated and ATP concen-trations increased, thus producing
more energy for the white cells. Recently our discoveries
have been connected to whey protein and colostrum, as
well as with natural organic salts of selenium, especially
Selol, which together lead to increased production of reduced glutathione, which I appreciate the most in connection with cell health as it is both an antioxidant and a
detoxifier. Detoxifica-tion by glutathione was described
in my article for the Warsaw School of Health in 2005. In
Nepal I collected Taxus wallichiana extracts and got some
preparations from the Chemistry Department, and the
Trent University students researched different concentrations of these extracts, with results that were presented to
the Cancer Society of India, of which I am a life member.
Taxol® and Taxote® clinically used in Canada were discussed in 1992 at the Second Princess Chulabhorn Congress in Bangkok by Ruchirawat, Nxumale and myself as
dangerous when used at concentrations of 10–6 or even
10–12 molar, because the chromosomal aberrations due
to the treatment could lead to secondary cancers. So the
Taxus is the dangerouse plant. Several years later Zobel
and Schellenberger developed a mixture of a very low
concentration of Taxol with coumarin which reacted synergistically even if paclitaxel (Taxol®) was at a 10–18 molar
concentration. Coumarin, a simple benzo-pyrone, is very
widely distributed in plants, and it had been used in a
46
Abstracts Dublin oncology hospital for treatment of prostate cancer
there by Profs. Thornes and O’Kennedy. Coumarin is one
of 2000 coumarins – coumarin and its derivatives – used
as active remedies in clinical treatment. It is easily recognizable by everybody because it smells like new-mown
hay, from which it evaporates into the air. Thus sleeping
on hay is good for you! Dill, parsley, parsnip, Angelica
and carrot all smell strongly, in part because of coumarins
in their tissues, and these are released into the teas and
soups made from them.
References:
Kuras M, Pilarski R, Nowakowska J, Zobel A, Brzost K, Antosiewicz J, Gulewicz K (2009) J Ethnopharmacology 121: 140-147.
Majewska M (1985) Master’s degree work, Tannin coenocytes in
Polygonum amphibium, Warsaw University.
Podbielkowska M, Wałesa M, Zobel A (1981) Acta Soc Bot Polon
50: 563-566.
Stoilova I et al (2007) Herba Polonica 53: 45-54.
Suchocki P, Maciazek M, Suchocka Z, Remiszewska M, Dymecka
A, Ilasz R, Pokorski M, Zawada K, Wroczynski P, Zobel A (2008)
Proceedings of the 9th International Symposium on Pharma-ceutical and Biomedical Analysis, Gdańsk,Poland, June 8-12 p339.
Zobel A (1975) Acta SocBot Polon 44: 491-500.
Zobel A (1997) Coumarins in fruit and vegetables. In pp 173-203,
Tomas-Barabare ed. Clarendon, Oxford.
Zobel A (2000) Seminar on Nutrition for Children with Down’s Syndrome, Warsaw, Poland, Sept25.
Zobel A (2000) Free radicals, glutathione and health, in Drugs in Poland, Warsaw, Sept 21-22.
Zobel A (2007) Carcinogenic trans fats detoxified by glutathione, In
Health of Our Children, 43-49.
Zobel A, Schellenberger S (2000) Pharmacol Biol 38: 192-96.
2009
3.2
The beneficial health effect of
apples and apple juices
Jan Oszmiański
Wrocław University of Environmental and Life Science;
Department of Fruit and Vegetable Technology, Norwida 25,
50-375 Wrocław
e-mail: Jan Oszmianski <[email protected].
pl>
Fruits and their juices contain a broad spectrum of natural compounds that could account for the beneficial
health effect. Apples and apple juices have been shown to
possess both in vitro and in vivo antioxidant activities that
are attributed to their polyphenolic compounds (Block et
al., 1992; Steinmetz et al., 1996). The interest in these compounds has been growing continuously due to presumed
beneficial effects on several common diseases like cardiovascular diseases, certain cancers, diabetes mellitus,
or neurodegenerative diseases. Apples are a rich source
of polyphenolic constituents, which are distributed in
the pulp, skin, and seeds. The total polyphenol content
of apples represents about 0.01–1% of the fresh weight.
Content and composition in phenolic compounds vary
strongly in dependence of the apple variety (Wojdylo et
al., 2008), area of cultivation, and year of harvest. Main
structural classes include phenol carboxylic acid derivatives, catechins and di-, tri-, and oligomeric procyanidins,
dihydrochalcones, and flavonoid glycosides. The concentration of polyphenols in apple juices depends strongly
on the apple cultivar and the technology used to obtain
the juice. The process of clear juice production appears to
have an even greater influence on polyphenolic content
than the variation in cultivar. The oxidative conditions of
mash treatment and clarification, according to the common production practice for clear apple juice, considerably decrease the phenolic content in the product. However, in the case of cloudy apple juice the suppression of
enzymatic browning conditions and the lack of clarification prevent the loss of polyphenols (Oszmaiński et al.,
2007).
References:
Block R et al (1992) Nutr Cancer 18: 1-29.
Oszmaiński J et al (2007) Eur Food Res Tech 224: 755-762.
Steinmetz B et al (1996) J Am Diet Assoct 6: 1027-1039.
Wojdylo A et al (2008) J Agric Food Chem 56: 6520-6530.
Vol. 56 Bioactive
Plant
Compounds
— Structural and Applicative Aspects
3.3
Plants and plants extracts in ruminant
nutrition, production and microbiology
Małgorzata Szumacher-Strabel, Adam Cieślak
Poznan University of Life Sciences, Department of Animal
Nutrition and Feed Management, Wolynska 33,
60-637 Poznan, Poland
e-mail: Małgorzata Szumacher-Strabel <mstrabel@jay.
up.poznan.pl>
Plants compose a major source of nutrients for ruminants. However variety effects of plants and their particular active components on health has been observed
widely since antiquity, either in humans or in animals.
The Chinese began to use plants in medicinal therapies
5 000 years ago, and in 1550 BC, the Egyptians used extract from plants with active components for food preservation and in mummification ceremonies [1]. At the
beginning of the 20th century plants and plant extracts
have been considered as antimicrobial agents in animal nutrition, especially in modulating the competition
among different microbial populations with the objective
of improving the efficiency of energy and protein utilization in the rumen. Later on, the application of antibiotic
ionophores was achieved [1]. Recent legislation (Directive
1831/2003/CEE) [2] prohibited the use of growth promoting antibiotics in animal feeds in the European Union and
led to an increased interest in alternative factors that can
manipulate rumen fermentation. This leads researchers
again, after decades, towards plants and their extracts
rich in secondary plant metabolites. According to Wallace
et al. [3] there are several targets for rumen manipulation,
like breakdown of dietary and microbial protein (losses
of ammonia N), methane formation (losses of methane),
digestive disorders and fatty acid biohydrogenation, that
can be achieved by different phytofactors. Essential oils,
blends of secondary metabolites (e.g. essential oil of Juniperus oxycedrus, source of cadiene and pinene, Syzyginum
aromaticum, source of eugenol or lucerne as a source of saponins) obtained from plants by steam distillation or solvent extraction [4], are actually broadly tested as rumen
modifiers and thus as agents that economize ruminants
diets, optimize and enhance methane and ammonia production, alter ruminant products composition (milk and
meat). They are characterized as having a very diverse
composition, nature and activities. The most important
active compounds belong to two chemical groups: terpenoids and phenylpropanoids. These two groups originate
from different precursors of the primary metabolism and
are synthesized through separate metabolic pathways
from glucose and pentose [1]. Their mechanism of action
relies upon their activity on cell membrane and cell constituents or to interaction with chemical groups of proteins or enzymes [1, 5, 6]. However, general assumptions
must be verified because the effects of essential oils and
other bioactive components are the result of synergistic
interactions between individual components contained in
plant material. Obtained results are often conflicting and
mixed and are dependent upon additive concentration,
type of diet fed, species of animal, type of production,
47
stage of lactation etc. Respected results comprise changes
in volatile fatty acid production, protein metabolism (inhibition of hyper ammonia producing bacteria responsible for deamination and peptidolysis), methane production and milk or meat composition. Certain plant-derived
ingredients have also a specific antiseptic activity against
e.g. Escherichia coli strains either in adult animals or
against other active microorganisms at gut level in young
ruminants. Effects of bioactive compounds on rumen metabolism and microflora populations are tested using different methods: in vitro (batch culture, rumen simulation
technique) and in vivo (cannulated animals). Quality and
quantity of animal production are tested in production
condition taking into account availability, palatability and
feed back mechanisms [7]. To establish alterations of microbial populations by different plant factors Real Time
PCR and FISH methods are usually used. Examples of the
utilization of different plant compounds in ruminant nutrition will be presented during the conference.
References:
1. Calsamiglia S et al (2007) J Dairy Sci 90: 2580-2595.
2. EC (2003) Official J Eur Commun L268: 29-43.
3. Wallace RJ (2008) Nottingham Feed Conf.
4. Greathead H (2003) Proc Nutr Soc 63: 279-290.
5. Gustafson RH, Bowen RE (1997) J Appl Microbiol 83: 531-541.
6. Juven BJ et al (1994) J Appl Microbiol 76: 626-631.
7. Rochfort S et al (2008) Phytochem 69: 299-322.
48
Abstracts 3.4
The extract from berries of Aronia melanocarpa
as modulator of the generation of superoxide
anion radicals in blood platelets
Magdalena Kedzierska1, Beata Olas1,
Barbara Wachowicz1, Anna Stochmal2,
Wieslaw Oleszek2, Arkadiusz Jeziorski3,
Janusz Piekarski3, Rafal Glowacki4
1Department
of General Biochemistry, University of Lodz,
Banacha 12/16, 90-237 Lodz, Poland; 2Department of
Biochemistry, Institute of Soil Science and Plant Cultivation,
State Research Institute, Czartoryskich 8, 24-100 Puławy,
Poland; 3Department of Oncological Surgery, Medical
University of Lodz, Poland; 4Department of Environmental
Chemistry, University of Lodz, Pomorska 163, 90-236 Lodz,
Poland
e-mail: Beata Olas <[email protected]>
Blood platelets play an important role in the pathomechanism of altered hemostasis in cancers. Platelets from patients with cancer exhibit a variety of qualitative abnormalities. Various tumor cells can activate platelets in vitro
by contact, releasing ADP, thromboxane A2 or thrombin.
Preliminary data from our laboratory using specific biomarkers of oxidative/nitrative stress, including the level
of 3-nitrotyrosine and carbonyl groups, revealed that oxidative/nitrative stress in platelets from breast cancer patients occurs. Plant antioxidants protect cells against oxidative stress. Since oxidative stress (measured by different
biomarkers) in breast cancer patients is observed, the aim
of the study was to establish the effects of a polyphenol
rich extract from berries of Aronia melanocarpa (final concentration of 50 μg/mL, 5 min, 37oC) on superoxide anion
radicals (O2-·) generation and glutathione (GSH) in blood
platelets from patients with breast cancer and in a healthy
group in vitro. The extract from berries of A. melanocarpa
reduces different steps of platelet activation (adhesion to
collagen and aggregation). Moreover, our preliminary
results show that this extract reduced protein modifications induced by the oxidative stress in blood platelets
from not only healthy subjects, but also from breast cancer patients.
Materials and Methods: Blood platelets were isolated
from healthy subjects and patients, which were hospitalized in Department of Oncological Surgery, Medical University of Lodz, Poland. Generation of O2-· in platelets before and after incubation with the extract was measured
by cytochrome c reduction. Using HPLC, we determined
the level of glutathione in blood platelets. Stock solutions
of the extract of aronia (Aronox by Agropharm Ltd, Poland) was made in H2O at the concentration of 5 mg/mL;
kept frozen and was used for blood platelet experiments.
Results: We observed a statistically significant increase of
O2-· generation and a decrease of GSH in platelets from
patients with breast cancer (compared to the healthy
group). The extract from berries of A. melanocarpa added
to blood platelets significantly reduced the production of
O2-· in platelets not only from the healthy group, but also
from patients with breast cancer.
2009
The obtained results demonstrate the protective properties of the extract from berries of A. melanocarpa against
the oxidative stress in patients with breast cancer in vitro.
Acknowledgements:
This work was supported by grant 505/373 from University of
Lodz.
Vol. 56 Bioactive
Plant
Compounds
3.5
The antioxidative effects of anthocyanin-rich
extract from red cabbage leaves on oxidative/
nitrative alterations in blood platelet proteins
Joanna Saluk-Juszczak, Barbara Wachowicz
Department of General Biochemistry, University of Lodz,
Banacha 12/16, 90-237 Lodz, Poland
e-mail: Joanna Saluk-Juszczak <[email protected].
pl>
Recently, there is an increasing interest in screening
natural products present in diet and herbals for possible
antioxidative agents. Anthocyanins are natural pigments
widely distributed in nature and [1, 2] responsible for the
reds, purples, and blues in many flowers, fruits and vegetables [3]. Anthocyanins belong to the flavonoid group
of polyphenols, have a C6C3C6-skeleton typical for flavonoids. They are glycosylated polyhydroxy and polymethoxy derivatives of 2-phenylbenzopyrylium cation, i.e. the
flavylium cation. The main part of anthocyanins is its
aglycone, the flavylium cation, which contains conjugated
double bonds responsible for absorption of light around
500 nm causing the pigments to appear red to human
eye [4]. Anthocyanins are considered to contribute to the
healthiness of fruits and vegetables for their antioxidant,
anti-carcinogenic, anti-inflammatory, and anti-angiogenic
properties [5, 6]. Anthocyanins can also improve the nutritional value of processed foods by preventing oxidation
of lipids and proteins in the food products [7]. However,
there is no data about their role in oxidative stress in blood
platelets. The aim of this study was to investigate antioxidant effects of the anthocyanin-rich extract from red cabbage leaves (Brassica oleracea rubrum) against platelet protein damages, induced by peroxynitrite. Blood platelets,
anucleate megacaryocyte-derived cells are one of the key
elements of haemostasis. The blood platelet activation,
crucial for platelet function, plays an important role in the
physiological and pathological processes. The excessive
activation of platelets is responsible in part for thrombosis, atherosclerosis, ardiovascular and cerebrovascular
disorders [8]. Platelets generate reactive oxygen species
(ROS) that can be involved in regulation of platelet activation and modulation of platelet activity [9]. Regulation
of platelets function by ROS is due to decreased bioavailability of nitric oxide (NO) generated in vessel wall, since
NAD(P)H oxidase-generated ROS (mainly superoxide
anion O2-·) scavenge endothelial and platelet-derived NO
in a fast reaction generating peroxynitrite (ONOO-) as an
end product [10]. Peroxynitrite, a highly reactive agent
may modulate platelet activation and function. Induced
by ROS modifications of platelet action may be an important factor in the pathogenesis of platelet-related diseases
[11]. Modifications (oxidation and nitration) of platelet
proteins induced by peroxynitrite, are responsible for
altered response of these cells and may be an important
factor in the pathogenesis of various diseases [12]. Thus,
the defence mechanisms against peroxynitrite are very
important for normal cellular function and biological activities of blood platelets.
49
Materials and methods: Human blood was collected
into ACD solution (citric acid/citrate–dextrose; 5:1; v/v)
and then the platelets were isolated by differential centrifugation of blood as described by Wachowicz and
Kustroń [13]. The final platelet concentration was about
4 × 108 platelets/ml. The platelets were counted by the
photometric method according to Walkowiak et al. [14].
The entire platelets washing procedure was performed
in plastic tubes and carried out at room temperature.
Washed human platelets were suspended in the modified Tyrode’s Ca+2/Mg+2 free buffer (127 mM NaCl, 2.7
mM KCl, 0.5 mM NaH2PO4, 12 mM NaHCO3, 5 mM
Hepes, 5.6 mM glucose, pH 7.4). Platelet suspensions
were preincubated for 5 min; at 37oC with anthocyaninrich extract (used in a range 5–15 μM) and then treated
for 5 min; at 37oC with ONOO- (0.1 mM).The tested extract was obtained from Department of Ecophysiology
and Plant Development, University of Lodz. Peroxynitrite was synthesized according to the method of Pryor et
al. [15]. Freeze fractionation, (–70oC) of the peroxynitrite
solution formed a yellow top layer, which was retained
for further studies. The top layer typically contained
80–100 mM peroxynitrite as determined spectrophotometrically at 302 nm in 0.1 M NaOH (l302 nm= 1679 M–1.
cm–1). Detection of nitrotyrosine-containing proteins by
a competitive ELISA (c-ELISA) method was carried out
according to a modified method, described by Khan et
al. [16]. Samples of blood platelets after incubation with
extract and/or ONOO- were dissolved in lysis buffer (2%
Triton-X-100, 100 mM EDTA and 100 mM Tris/HCl; pH
7.4); and platelet lysates were used to study the level of
nitrotyrosine in proteins by c-ELISA method. The results
were expressed as nitrofibrinogen equivalents [mM],
according to the standard curve prepared by using nitrofibrinogen. The nitrofibrinogen was carried out at the
laboratory as a result of peroxynitrite treatment of native human fibrinogen.Detection of carbonyl groups by
an ELISA method in blood platelets (control or treated
with extract and/or ONOO-) was carried out according
to a method described by Buss et al. [17]. The amount of
carbonyl groups present in human blood platelets determined spectrophotometrically as described by Levine et
al. [18].
Results and discussion: The incubation of blood platelets
with ONOO- leads to oxidative/nitrative stress in these
cells. It results in the increase of carbonyl group and 3nitrotyrosine levels. The ELISA test used to estimate proteins carbonylation caused by ONOO- action, showed that
the anthocyanin-rich extract from red cabbage prevented
against blood platelet protein modifications. In the presence of tested extract the distinct reduction of platelet
protein oxidation was observed. The effectiveness of extract action on platelet protein alterations is dependent
on its doses. Preincubation of blood platelets with extract decreased the level of carbonyl groups in the dose
dependent manner (by 34% at the highest concentration
of extract), p<0.05 (Fig.1). The level of 3-nitrotyrosine is a
very useful marker of protein modification in oxidative/
nitrative stress. Our studies indicate, that the tested extract might be effective in protection against the nitrative
action of peroxynitrite. The level of 3-nitrotyrosine, measured by a competition-ELISA method, was diminished in
50
Abstracts 120
100
%
80
60
40
20
0
0
5
10
15
Concentrations of extract [μM]
Figure 1. The effect of different concentrations of anthocyaninrich extract (5–15 μM) on carbonyl group formation (protein
oxidation) in blood platelets treated with ONOO- (0.1 mM).
The protein oxidation was measured immunologically using Elisa method. The results are expressed as % versus control platelets
(treated only with ONOO-; without extract). The results are representative of four independent experiments, and are expressed
as means ± SEM.
the presence of cabbage leave extract. Preincubation of
human platelets with extract resulted in drastic decrease
of the level of 3-NT, in the dose dependent manner, even
by 70% at the highest dose of extract; p<0.05 (Fig.2). The
protective ability of anthocyanin-rich extract against 3-nitrotyrosine formation induced by peroxynitrite indicates
that anthocyanins from red cabbage may protect platelet
proteins against not only oxidative but also nitrative toxic
effects of peroxynitrite. Diet is the first line in the prevention of various cardiovascular diseases, but very little is
known about the effect of diet and nutrition on blood
platelet activities. In the past few years, epidemiological, clinical and in vitro studies have shown the inverse
associations between human diet with antioxidative and
antiplatelet properties and mortality from cardiovascular
diseases [19]. There are many nutritive and non-nutritive
compounds present in the diet, which may affect platelet
- ONOO-
nmol 3-NT/mg proteins
0,25
+ ONOO-
0,2
0,15
0,1
0,05
0
0
5
10
15
Concentrations of extract [μΜ]
Figure 2. The effect of different concentrations of anthocyaninrich extract (5–15 μM) on nitration of tyrosine residues in platelet proteins induced by ONOO- (0.1 mM).
The tyrosine nitration was measured by C-ELISA method and
results are expressed as nmol nitrotyrosine-Fg/mg of platelet
proteins.The results are representative of three independent experiments, and are expressed as means ± SEM.
2009
function in various ways [19]. Therefore the compounds
that inhibit platelet function are of great interest. Here, we
have presented that the anthocyanin-rich extract from red
cabbage leaves (Brassica oleracea rubrum) has the protective effects against the changes in blood platelet proteins
(carbonylation, nitrotyrosine formation) caused by peroxynitrite. The extract possesses antioxidative properties
and protects platelet proteins against toxicity induced by
very strong oxidant — peroxynitrite. In conclusion, the
results obtained in this work suggest that the consumption of natural products containing anthocyanins may
have effects on maintaining or improving cardiovascular
health that frequently emerge in association with oxidative stress and changes of platelet function.
References:
1. Clifford MN (2000) J Sci Food Agric 80: 1063-1072.
2. Kong J, Chia L, Goh N, Chia T, Brouillard R (2003) Phytochemistry 64: 923-933.
3. Rossi A, Serraino I, Dugo P, Di PR, Mondello L, Genovese T,
Morabito D, Dugo G, Sautebin L, Caputi AP, Cuzzocrea S (2003)
Free Radic Res 37: 891-900.
4. Brouillard R (1982) Academic Press Inc New York, p1-38.
5. Kähkönen MP, Heinämäki J, Ollilainen V, Heinonen M (2003) J
Sci Food Agric 83: 1403-1411.
6. Kähkönen MP, Hopia AI, Heinonen M (2001) J Agric Food Chem
49: 4076-4082.
7. Viljanen K, Kivikari R, Heinonen M (2004) J Agric Food Chem
52: 1104-1111.
8. Blockmans D, Deckmyn H, Vermylen J (1995) Blood Rev 9: 143156.
9. Wachowicz B, Olas B, Zbikowska HM, Buczynski A (2002)
Platelets 13: 175-182.
10. Nowak P, Wachowicz B (2001) Platelets 12: 376-381.
11. Nowak P, Wachowicz B (2001) Cytobios 106: 179-187.
12. Nowak P, Olas B, Bald E, Glowacki R, Wachowicz B (2003)
Platelets 14: 375-379.
13. Wachowicz B, Kustroń J (1992) Cytobios 70: 41-47.
14. Walkowiak B, Michalak E, Koziołkiewicz W, Cierniewski CS
(1989) Thrombos Res 56: 763-766.
15. Pryor WA, Squadrito GL (1995) Am J Physiol 268: L699-722.
16. Khan J, Brennan DM, Bradley N, Gao B, Brukdorfer R, Jacobs
M (1998) Biochem J 330: 795-801.
17. Buss H, Chan TP, Sluis KB, Domigan NM, Winterbourn CC
(1997) Free Radic Biol Med 23: 361-366.
18. Levine RL, Garland D, Oliver CN, Amici A, Climent I, Lenz
AG, Ahu BW, Shaltiel S, Stadtman ER (1990) Methods Enzymol
186: 464-478.
19. Halliwell B (2000) Cardiovascs Res 47: 410-418.
Acknowledgements:
This work was supported by the grant 505/374 from the University of Lodz.
Vol. 56 Bioactive
Plant
Compounds
3.6
The different influence of (-)-epicatechin
on DNA damage and antioxidant status
in healthy and leukemic rats
Monika A. Papież
Department of Cytobiology, Pharmaceutical Faculty, The
Jagiellonian University, Kraków, Poland
e-mail: Monika Papież <[email protected]>
Growing number of data from in vitro and in vivo studies
indicate that tea polyphenol (-)-epigallocatechin-3-gallate (EGCG) protects cells from oxidative stress-induced
DNA damage and possesses chemopreventive properties. Currently, the most abundant tea polyphenol EGCG
is in the centre of interest as potential compound, which
can be applied as complementary therapy to the treatment of cancer. Little data exists on the chemopreventive
properties of (-)-epicatechin in in vivo study. The aim of
the study was to compare the influence of (-)-epicatechin
on DNA damage and antioxidant status in healthy control and leukemic rats. The Brown Norway rat with acute
myeloid leukemia (BNML) was used in the present work.
The leukemia was induced through intravenous injection
(i.v.) of BNML cells (generous gift from Prof. A.C. Martens, Utrecht) to the BN rats. The experimental rats were
given epicatechin (EC) in a dose of 40 mg/kg b.w. in 0.5 ml
water by gavage for 23 consecutive days. The control rats
were only given a vehicle. The rats were killed at 24 h after
the last dose of EC. The spleen was excised and weighted.
Single cell suspensions were prepared from the part of
spleen. The rest of the organ was processed for histologic
analysis. The amount of DNA damage was estimated by
a single cell electrophoresis in agarose gel (a comet assay), using the Comet assay 2.6 software. The intracellular redox state was assessed in liver by measurement
of the ferric ion–reducing antioxidant power (FRAP) and
malonodialdehyde (MDA) concentration as an indicator
of lipid peroxidation. The measurements were performed
spectrophotometrically.
The extent of DNA damage was significantly greater in
spleen of leukemic rats compared to the healthy control.
The oxidative stress was observed in liver of BNML rats
due to decrease of FRAP values and significantly increase
of MDA content compared to the healthy groups. Examined polyphenol significantly lowered the extent of DNA
damage in spleen cells and exerted antioxidant action in
liver of leukemic rats. FRAP values increased and MDA
content decreased significantly in liver of BNML rats
treated with EC compared to the untreated leukemic
group. EC did not significantly influence the extent of
DNA damage and oxidative status of healthy control rats.
The weight of spleen isolated from EC-treated leukemic
rats was significantly reduced compared to the untreated
group. In contrary, EC administration did not significantly influence of the spleen weigh in healthy control rats.
Moreover, the number of leukemic cells infiltrating the
spleen of EC-treated leukemic rats was lowered compared to the untreated ones.
Obtained results indicate that EC activity leads to restriction of the number of cells with increased level of muta-
51
tion and diminish the oxidative stress in BNML rats. It is
regarded that accumulation of mutations in genes of myeloid leukemia cells contribute to the elevated production
of reactive oxygen species (ROS). The increased oxidative
stress leads to enhancement of genomic instability. Such
mechanism can drive the progression of leukemia. It was
observed that EC suppressed progression of the disease
and prevented against invasiveness of leukemic cells. It
is concluded that EC exerts chemopreventive action in
BNML rats.
52
Abstracts 3.7
Cross-reactivity of native and hydrolysed
pea and peanut proteins
Agata Szymkiewicz, Anna Radzioch
Department of Immunology and Food Microbiology, Institute
of Animal Reproduction and Food Research of Polish Academy
of Sciences, Tuwima 10, 10-747 Olsztyn, Poland
e-mail: Agata Szymkiewicz <a.szymkiewicz@pan.
olsztyn.pl>
Peanuts are the most common cause of food related
deaths. They have been found to contain 10 identified
strong allergens (Kilanowski et al., 2006). In pea 2 allergens have been identified so far but their allergenic potential is not as strong as that of peanuts (Sánchez-Monge
et al, 2004). Both peanuts and pea belong to the legumes;
due to phylogenetical and antigenical affinities among
these plants a high cross-reactivity level can be expected
(Ibaňez et al., 2003). Yet, the available data do not seem to
confirm this. The aim of the study was to determine the
level of cross-reactivity between pea and peanut proteins
and to assess the effect of enzymatic hydrolysis on the allergenic potential of these proteins. The results obtained
should provide answer to the question if hydrolysed pea
proteins could be used for immunotherapy in patients
with peanut allergy.
Material and methods: Protein isolates obtained from
pea seeds and peanuts as well as purified globulin proteins (7S and 11S) were used for analyses. Globulins were
isolated from meal according to Freitas et al. (2000). Particular globulin fractions were further purified on the ionexchange chromatography column (DEAE-Sepharose).
Hydrolysis of protein solution (3mg/ml) was carried out
in a “two-step” system with Alcalase (pH 8) as endoprotease and Flavourzyme (pH 7) as exopeptidase at the temperature of 50oC for 180 min. The enzymes were added
in the amount of 15mAU/g protein. Hydrolytic enzymes
were inactivated by heating at the temperature of 90oC
for 5 min. After cooling, the hydrolysates were frozen,
freeze-dried and subjected to further analysis. Cross-reactivity between pea and peanut proteins and reduction
of immunoreactivity were analysed with competitive
ELISA.
Results and discussion: Native proteins of the isolate obtained from pea seeds and peanuts revealed a low crossreactivity level. In the cases when antibodies obtained
against peanut isolate proteins were used, it was shown
that pea legumin reacted with the antibodies at the level
as low as 1%. Neither pea isolate proteins nor purified
pea vicilin showed such reaction. A similar relation was
observed when antibodies obtained against pea isolate
proteins were used for analysis. The antibodies reacted
with peanut legumin at the level of ca. 3%; no such reaction was observed for peanut vicilin. A slightly higher
level of cross-reactions (ca. 8%) was found between type
11S proteins of both species, which is justified by the fact
that the affinity of amino acid sequence of peanut and
pea legumins is 62–72% (Rabjohn et al., 1999). It is worth
noticing that no cross-reactions were found between pea
and peanut vicilin, which is quite puzzling as homology
2009
in the amino acid sequence of vicilin in both species is
ca. 60–65% (Burks et al., 1995). Yet, the available literature
does not provide any univocal findings concerning crossreactivity between these proteins. It is commonly accepted that such reactions do not occur but Wensing et al.
(2003) proved high affinity between the epitopes of peanuts (Ara h 1) and pea vicilin, which could trigger clinical
symptoms following intake of these seeds. Lack of crossreactivity between 7S type proteins of pea and peanuts
may suggest that not only homology of amino acid sequence decides about immunological affinity of proteins.
Contradictions in the reports on cross-reactivity in vitro
and clinical cross-allergenicity may arise from the fact
that mostly native proteins are used for studies whereas
in the our work it was clearly showed that cross-reactivity
level considerably increased after protein hydrolysis, i.e.
following revealing internal epitopes. The proteins of hydrolysed pea legumin were bound to antibodies specific
against proteins of peanut isolate at the level of over 10%.
In the case of the proteins of hydrolysed pea vicilin the
level was ca. 50%. The proteins of peanut vicilin hydrolysate reacted with antibodies specific against pea isolate
proteins at the level of 20%, and of peanut legumin- at
26%. Enzymatic hydrolysis conducted with the use of Alkalase very effectively lowered immunoreactivity of pea
proteins. The hydrolysates obtained from isolates of these
proteins were characterized by 27% reactivity compared
to the immunoreactivity of native proteins. The immunoreactivity of hydrolysed pea legumin was ca. 36%, and of
vicilin – below 45%. Lowering immonoreactive properties
was accompanied by high degradation rate of these proteins. Alkalase is an endopeptidase with low specificity
of activity; it attacks peptide bonds in quite an accidental manner; hence, most likely, the high hydrolysis level
achieved while using this enzyme and relatively fast decrease in immunoreactivity of the proteins studied. Such
way of Alkalase action causes that already in the first
stage of hydrolysis there occurs immediate destruction
of surface epitopes with high affinity to antibody paratope followed by significant reduction in antigenicity of
proteins, while further hydrolysis destroys more stable
epitopes which may be either more stable surface epitopes
or partly masked or protected epitopes inside protein
molecules (Mahmoud et al., 1992). Two-step hydrolysis
with the use of Alkalase and Flavourzyme reduced the
immunoreactivity of pea protein isolates even more, to
the level below 7%, and of pea legumin and vicilin – to
ca. 5%. Clemente et al. (1999) conducted chickpea protein
hydrolysis in one- and two-step system with Alkalase and
Flavourzyme. Their results also indicate that two-step hydrolysis is the most effective in reducing immunoreactivity. The activity of Alkalase causes increase in the number
of final peptides and provides better conditions for the activity of Flavourzyme. Such system of hydrolysis leads to
obtaining preparations containing compounds with very
low molecular masses, which has a significant effect on
their potential to induce allergenic reactions. Mahmoud
(1994) reported that hydrolysis intensive enough should
be used for the production of hypoallergenic formulas to
ensure that the final product will be dominated by free
amino acids and very short (di-, tri-) peptides. Van Beresteijn et al. (1994) determined the minimum molecular
mass of peptides obtained after whey hydrolysis able to
Vol. 56 Bioactive
Plant
Compounds
induce immunological response to the value of 3–5 kDa.
Van Hoeyveld et al. (1998), in turn, reported that the minimum molecular mass required for in vitro binding IgE
was 970–1400 kDa. Peanut proteins, characterised by high
allergenic potential, also underwent deep hydrolysis, but
their immunoreactivity remained on a very high level,
which may indicate high stability of epitopes. Immunoreactivity of proteins present in the isolate was lowered
to the level of ca. 67% following hydrolysis with the use
of Alkalase. Under the same hydrolysis conditions the
number of epitopes reacting with antibodies increased
considerably in the case of isolated fractions containing
the most allergenic peanut proteins. The immunoreactivity of peanut glycinins (Ara h 3 and Ara h 4) and arachin
(Ara h 1) rose by over 60% compared to the immunoreactivity of native fractions.
The subsequent step of hydrolysis, with the use of Fluorozyme, resulted in slight lowering of immunoreactive
properties of peanut proteins. Yet, the level of immunoreactivity was lower compared to the pre-hydrolysis sample only when all proteins were hydrolysed simultaneously. Such high immunoreactivity may follow from the
fact that that majority of the most immunogenic epitopes
present in Ara h 1 or glycinin allergens are of a linear
character. They are the most resistant to enzymatic hydrolysis of not only digestive enzymes (Maleki et al., 2000)
but also of endopeptidase and exopeptidase preparations
as the results presented indicate. Application of two-step
hydrolysis in such a system usually leads to considerable
reduction of protein allergenic potential. In the first place,
structural epitopes are hydrolysed, next – linear epitopes,
which are generally stable in the conditions of technological food processing (Besler et al., 2001). Destruction of linear epitopes may take place due to chemical modification
or enzymatic hydrolysis. Most enzymes are characterized
by specific activity and it is the enzyme specificity, and
first of all amino acid sequence, that decides the hydrolysis degree of active epitopes. In spite of high affinity in
the amino acid sequence of pea and peanuts, allergenic
potential is reduced somewhere else. It appears that pea
epitopes may mostly have structural character, which
would account for lack of cross-reactivity to peanut proteins. Hence, pea proteins might be used in the immunotherapy of patients with peanuts allergy, but as there
is no absolute certainty, it must be confirmed on animal
model first.
References:
1. Besler M, Steinhart H, Paschke A (2001) Satbility of food alergenicity of processed foods-review. J Chromatography B 756: 207228.
2. Burks AW, Cocrell G, Stanley JS, Helm RM, Bannon GA (1995)
Recombinant peanut allergen Ara h 1 expression and IgE binding in patients with peanut hypersensitivity. J Clin Invest 96:
1715-1721.
3. Clemente A, Vioque J, Sáchez-Vioque R, Pedroche J, Millán F
(1999) Production of extensive chickpea (Cicer arientinum L) protein hydrolysates with reduced antigenic activity. J Agric Food
Chem 4: 3776-3781.
4. Freitas RL, Ferreira RB, Teixeira AR (2000) Use of a single
method in the extraction of the seed storage globulins from several legume species. Application to analyse structural comparisons within the major classes of globulins. Inter J Food Sci Nutrition 51: 341-352 .
5. Ibaňez D, Martinez M, Sanchez JJ, Fernández-Caldas E (2003)
Legume: cross-reactivity. Allergol Immunopathol 31: 151-161.
53
6. Kilanowski J, Stalter AM, Gottesman MM (2006) Preventing
peanut panic. J Pediatric Health Care 20: 61-66.
7. Mahmoud MI (1994) Physicochemical and functional properties of protein hydrolysates in nutritional products. Food Technol
11: 89-95.
8. Maleki SJ, Kopper RA, Shin DS, Park Ch-W, Comparde CM,
Sampson H, Burks AW, Bannon GA (2000) Structure of the major
peanut allergen Ara h 1 may protect IgE-binding epitopes from
degradation. J Immunol 164: 5844-5849.
9. Rabjohn P, Helm RM, Stanley JS et al (1999) Molecular cloning
and epitope analysis of the peanut allergen Ara h 3. J Clin Invest
103: 535-542.
10. Sánchez-Monge R, Lopez-Torrejon G, Pascual CY, Varela J,
Martinez-Esteban M, Salcedo G (2004) Vicilin and convicilin are
potential major allergens from pea. Clin Exp Allergy 34: 17471753.
11. Van Beresteijn EC, Peeters RA, Kaper J, Meijer R, Robben A,
Schmidt D (1994) Molecular mass distribution, immunological
properties and nutritive value of whey protein hydrolysates. J
Food Prot 57: 619-625.
12. Van Hoeyveld EM, Escalona-Monge M, Deswert LFA, Stevens
EA (1998) Allergenic and antigenic activity of peptide fragments
in a whey hydrolysate formula. Clin Exp Allergy 28: 1131-1137.
13. Wensing M, Knulst AC, Piersma S, O’Kane F, Knol EF, Koppelman SJ (2003) Patients with anaphylaxis to pea can have
peanut allergy caused by cross-reactive IgE to vicilin (Ara h1). J
Allergy Clin Immunol 111: 420-424.
Acknowledgements:
The work was financed from the research funds in the years
2008-2011 as Research Project No 2507/B/PO1/2008/34.
54
Abstracts 3.8
New buckwheat product — changes of
proteins and aminoacids as an effect of
fermentation by strain Rhisopus oligosporus
Karolina Christa, Maria Soral-Śmietana
Institute of Animal Reproduction and Food Research of Polish
Academy of Sciences, Department of Functional Properties of
Food, Tuwima 10, 10-747 Olsztyn, Poland
e-mail: karolina christa <[email protected]>
Preservation of food by fermentation is a widely practiced
technology. Fermentation ensures not only microbiological safety but also make some food more digestible and
reduces toxicity substrates. Throughout the world there
are many different types of fermented food in which
range of different substrates are metabolised by a variety of microorganisms. Tempeh is a traditional, fermented Indonesian food, produced from soybean by fungus
Rhizopus oligosporus. Apart from the soybean, pea, bean,
buckwheat and corn are also applied for tempeh production. During tempeh fermentation Rhizopus oligosporus
synthesizes various enzymes, which hydrolyse raw material and change its texture, taste and aroma. This process also reduces or eliminates anti-nutritive components
in the fermented products. Buckwheat grains distinguish
an amount of proteins, starch and vitamin. The proteins
consists of well-balanced aminoacids with a high biological value and is excellent supplement for cereal grains,
although the digestibility is relatively low. However,
some information indicate that buckwheat proteins contains allergen, and the allergy reaction is a health problem
that have been in the custom of consuming buckwheat
products. Some food-processing techniques have been
applied to foods in order to increase the functional properties and to reduce a level of allergenic proteins. In the
present study it was tried to modify buckwheat grains
using a fungi, Rhizopus oligosporus to increase functional
properties and eliminate allergenic proteins. The spores
of R. oligosporus were mixed with steamed buckwheat
grains, then they were incubated at 30°C, 85% relative
humidity (RH) for 24 h. The changes of aminoacids, allergenic proteins in the grains and in vitro digestibility were
determined after the incubation process. Analysis of the
digestibility of the buckwheat proteins preparations conducted in the environment stimulating physiological conditions of digesting proteins in the duodenum. The 24h-fermented buckwheat (FeB) was found to be involved
in formation of aminoacids with higher amounts of total
aminoacids, and some of them increased several times
more; including leucine, lysine, valine, glycine, histidine,
tyrosine. SDS/PAGE showed that R. oligosporus was very
efective to reduce allergenic proteins of buckwheat. The
pattern of proteins in the control sample varies with molecular mass, both of high and low molecular mass proteins were degraded by R. oligosporus during the fermentation. In addition, increase from 15.85% to 37.8% of total
proteins content formed in fermentation process was also
observed. Analysis in vitro digestibility showed that the
applied fermentation had triggered the improvement in
the digestibility of examined buckwheat proteins: 82.7%
2009
— before; 87.07% — after fermentation. From the present
results, it was concluded that fermented buckwheat grains
may be a big prospect as a food ingredient, that contains
important nutritive substrates and helps in the development of hypoallergenic buckwheat as a new product.
Vol. 56 Bioactive
Plant
Compounds
3.9
Antioxidant capacity of the extracts from aerial
parts of common and tartary buckwheat as a
tool for selection of high utility material
Danuta Zielińska
University of Warmia and Mazury in Olsztyn, Faculty of
Environmental Management & Agriculture, Chemistry
Department, Olsztyn, Poland
e-mail: Danuta Zielinska <[email protected]>
Abstract: The antioxidant capacity of 80% methanolic
extracts from stems, leaves, flowers and mature seeds
of common and tartary buckwheat during growth period was determined against ABTS·+ (TEAC assay) and
O2-• radicals (PCL assay). The antioxidant capacity of
aerial parts of buckwheat was highly differentiate during growth period. The highest antioxidant capacity was
noted in flowers of common buckwheat during growth
period and in leaves of tartary buckwheat during flowering. It was concluded that both applied assay can be used
as a tool for the selection of high utility material from
buckwheat.
Introduction: Buckwheat is an important crop in some areas of the world which refers to any member of Fagopyrum
family (Polygonaceae). There are many species of buckwheat and mainly nine species have agricultural meaning.
Among them, only common buckwheat (F. esculentum)
and tartary buckwheat (F. tartaricum) are of increasing
concern (Jiang et al., 2007). The genus Fagopyrum is an
important native source of flavonoids and good source for
rutin extraction (Fabjan et al., 2003; Kalinova & Dadakova,
2004). These compounds, mainly responsible for the antioxidant potential of buckwheat-derived material, have
recently been shown to be potent antioxidants in cultured
cells (Wolf et al., 2008), an excellent metal ion chelators
and can prevent copper-catalysed peroxidation of low
density lipoproteins (Scalbert et al., 2005). Human studies
55
of flavonoids have also demonstrated effects that can in
part be attributed to their antioxidant action (Williamson
& Manach, 2005). Nowadays, healthiness is considered as
one of the key drivers in food business, and both agricultural and pharmaceutical industry look for the natural
material of high antioxidant capacity as a potentially a
new source of flavonoids. Therefore, the intention of the
present work was to find out whether antioxidant capacity assays can serve as a tool for selection of high antioxidant material from aerial parts of buckwheat.
Materials and Methods: In the year 2008 common buckwheat variety Volma and tartary buckwheat were sown
on an experimental fields in Bałcyny near Ostróda in Production-Experimental Station of the University of Warmia and Mazury in Olsztyn. During vegetation period there
was no mechanical or chemical treatment of the growths.
The material for analysis was harvested in three stages
(early flowering, flowering and seed formation, and seed
ripening) and divided into the parts for analysis (leaves,
stems, and flowers). About five randomly selected plants
per each stage were collected to obtain enough aerial parts
of both type of buckwheat. This material was immediately
frozen and freeze-dried. The seeds were harvested in optimum maturity and were also freeze-dried. Material was
milled into dust and it was stored at –40°C in polyethylene bags. About 100 mg of pulverized buckwheat material was extracted with 1 mL of 80% methanol at room
temperature. Next, the mixture was vortexed for 30 s,
sonicated for 30 s and centrifuged for 5 min (13200 × g at
4oC). That step was repeated five times and supernatants
were collected in 5 mL flask. Finally, all extracts were kept
at –40oC prior to further analysis. The AC of the extracts
was evaluated against stable, non-biological radicals such
as ABTS·+ radical cation (TEAC assay) using a spectrophotometer UV-160 1PC with CPS-Controller (Shimadzu,
Japan), and against the key reactive oxygen intermediate
— O2-• radical by photochemiluminescence (PCL) assay
using Photochem® apparatus (Analytik Jena, Leipzig,
Germany) as it was reported previously (Zielińska et al.,
2007). The AC was presented independently of the tech-
Table 1. The antioxidant capacity of aerial parts of common (CB) and tartary buckwheat (TB) provided by TEAC assay (μmol
Trolox/g d.m.)*.
DAS
41 (CB 41 (TB)
Phenological state
Early flowering
48 (CB) 62 (TB)
Flowering and seed
formation
100 (CB)100 (TB)
Seed ripening
Aerial part
Stems
Leaves
Flowers
Stems
Leaves
Flowers
Unripe seeds
Ripe seeds
Common buckwheat
77.1 ± 8.3aA
144.4 ± 33.3cA
735.2 ± 29.1bA
58.2 ± 3.2aA
267.8 ± 35.1dA
867.1 ± 57.3eB
723.2 ± 45.7bA
43.2 ± 0.4aA
Tartary buckwheat
80.0 ± 11.2aA
309.0 ± 15.8cB
723.2 ± 24.8bA
71.0 ± 5.9aB
380.5 ± 60.6dA
758.3 ± 66.3bA
780.8 ± 38.1bA
75.5 ± 2.8aB
*Data expressed as means ± standard deviations of three independent extractions (n = 3). Means in a column followed by the different lower case letter correspond to significant
differences (p<0.05). Means in the same raw followed by capital letter correspond to significant differences (p<0.05).
Table 2. The antioxidant capacity of aerial parts of common and tartary buckwheat provided by PCL assay (μmol Trolox/g d.m.)*.
DAS
41 (CB) 41 (TB)
Phenological state
Early flowering
48 (CB) 62 (TB)
Flowering and seed
formation
100 (CB)100 (TB)
Seed ripening
Aerial part
Stems
Leaves
Flowers
Stems
Leaves
Flowers
Unripe seeds
Ripe seeds
Common buckwheat
64.3 ± 8.8abA
292.4 ± 66.6cA
589.4 ± 3.2dA
86.3 ± 15.4abA
549.4 ± 54.7dA
1065.9 ± 212.9eA
187.9 ± 9.2bcA
8.6 ± 0.2aA
Tartary buckwheat
146.4 ± 16.5cB
426.9 ± 18.8aB
420.1 ± 17.2aB
82.1 ± 9.1bA
387.0 ± 46.9aB
508.3 ± 71.40dB
190.4 ± 6.2cA
71.1 ± 2.0bB
56
Abstracts niques used as TE values (mM Trolox). Statistical analysis
was performed using Fischer LSD test and significance
level was set at p<0.05.
Results: Results indicated for highly differentiate of AC
values of leaves and flowers from common and tartary
buckwheat collected during early flowering as well as
during flowering and seed formation stage of vegetation (Tables 1 and 2). The leaves from tartary buckwheat
showed higher AC values by 113% (early flowering) and
42% (flowering and seed formation) than those from
common buckwheat. This tendency was observed for
both used AC assays with one unclear exception for AC
value of tartary buckwheat leaves during flowering and
seed formation stage when result was provided by PCL
assay.
The highest AC values of the buckwheat flowers were
observed from early flowering stage up to the full flowering and first unriped seed formations. In contrast to
buckwheat leaves, a higher AC values were found for
flowers from common buckwheat by 14% (TEAC assay)
and 109% (PCL assay) when compared to those from tartary buckwheat. The AC values of stems from common
and tartary buckwheat showed the lowest values which
were not dependent on the stage of vegetation. A drastic
reduction of AC due to the ripening stage resulted in the
lowest AC values of seeds.
Discussion: The intention of the present work was to
find out whether aantioxidant capacity assays can serve
as a tool for selection of high utility material from aerial
parts of buckwheat. In this study, a higher AC values of
the aerial parts of common and tartary buckwheat were
provided by PCL technique than TEAC assay. However,
a positive value of correlation coefficient between results
obtained by TEAC and PCL assays (r = 0.67) indicates
that both methods were applicable for the evaluation of
AC of buckwheat material. Therefore, flowers from common buckwheat harvested during whole flowering stage
and leaves from tartary buckwheat collected during full
flowering stage can be recommended as a buckwheat
material with the highest antioxidant capacity. This suggestion was in agreement with others studies focused on
the selection of buckwheat material as a source of rutin
content [1-3, 8]. It can be concluded that evaluation of
antioxidant capacity of plant material could be useful
for selection of high utility material for food, feed and
pharmaceutical industry purposes.
Abbreviations:
AC — antioxidant capacity; TEAC — trolox equivalent antioxidant capacity; ABTS·+ — 2,2’-azinobis-(3-ethylbenzothiazoline6-sulphonate) radical cation; PCL — Photo Chemical Luminescence; O2-• — superoxide anion radical; TE — trolox equivalent;
DAS — days after seeding.
References:
Jiang P, Burczynski F, Campbell C, Pierce G, Austria JA, Briggs
CJ (2007) Food Res Int 40: 356-364.
Fabjan N, Rode J, Kosir IJ, Wang ZH, Zhang Z, Kreft AI (2003) J
Agric Food Chem 51: 6452-6455.
Kalinova J, Dadakova E (2004) Proceedings of the 9th International
Symposium on Buckwheat: 719-722.
Kreft S, Knapp M, Kreft I (1999) J Agric Food Chem 47: 4649-4652
Scalbert A, Johnson IT, Saltmarsh M (2005) Am J Clin Nutr 81:
215S-217S.
Williamson G, Manach C (2005) Am J Clin Nutr 81: 243S-255S.
2009
Wolf KL, Kang X, He X, Dong M, Zhang Q, Liu RH (2008) J Agric
Food Chem 56: 8418-8426.
Zielińska D, Szawara-Nowak D, Ornatowska A, Wiczkowski W
(2007) J Agric Food Chem 55: 9891-9898.
Acknowledgements:
These studies were supported by the University of Warmia and
Mazury in Olsztyn, Poland (Research grant No. 1002-0215).
Vol. 56 Bioactive
Plant
Compounds
3.10
Essential oils and secondary plant
metabolites in dairy cow feeding
Małgorzata Szumacher-Strabel, Agnieszka
Nowakowska, Paweł Zmora, Adam Cieślak
e-mail: Małgorzata Szumacher-Strabel <mstrabel@jay.
up.poznan.pl>
Essential oils are blend of secondary metabolites obtained
from plant by steam distillation or solvent extraction [1].
Considerable efforts has been devoted towards developing alternatives to antibiotics in animal nutrition [2].
Plant extracts rich in secondary plant metabolites (SPM)
offer a unique properties acting as rumen modulators.
They exhibit a wide range of antimicrobial activities [3]
that depends on plant, parts of plant they were extracted
and chemical structure. According to Cardozo [4] essential oils can reduce protein degradation and modulate rumen fermentation by reduction of particular volatile fatty
acid concentration and decreasing bacterial population.
Reduced protein degradation by reduction of deamination is connected with inhibited growth of specific group
of rumen bacteria – hyper ammonia producing bacteria
(HAP). Because deamination of amino acids (AA) in the
rumen, which leads to the loss of ammonia across the ruminal wall and as a consequence increase ammonia release to the atmosphere, is one of the main causes of inefficient N retention by ruminants, there is big interest in
deactivation of bacteria responsible for this process. The
most common species of these bacteria are: Clostridium
sticklandii, Clostridium aminophilum, Bacteroides ruminicola
and Peptostreptococcus anareobius. HAP are present in low
numbers in the rumen but they are very active in ammonia production (up to 50%) [5]. Occurrence of this group
of bacteria depends on the diet and geographical latitude
[6]. Also the mitigation of methane emission by the rumen microbes using various chemical modifiers has been
investigated extensively [7]. The use of plant secondary
metabolites as rumen modifiers seems to be a better approach since these are natural products that might be environment friendly and have better acceptance with the
consumer [8]. The objectives of the present study were (i)
to evaluate the anti-HAP potential of SPM, (ii) to explore
antimethanogenic potential of SPM and (iii) to evaluate
the effects of SPM on rumen fermentation parameters in
the rumen fluid in vitro.
Material and methods: Ruminal contents were obtained
from fistulated cows and squeezed through four layers of
cheesecloth into four fermenter rumen simulation techniques (RUSITEC, 8). Two experiments were conducted.
Each treatment was repeated twice in experimental period of ten days each. The supplements (eugenol or vanillin) were added to a basal diet on three dosage levels (4,
40 and 400 mg/L of rumen fluid). The ammonia was quantified spectrophotometrically using the modified Nessler
method as described by Szumacher-Strabel et al. [10]. The
concentration of volatile fatty acid was determined by gas
57
chromatography (VARIAN CHROMAPACK, CP-3380)
according to Tangerman and Nagengast [11]. Samples for
ciliates counts were collected and fixed with an equal volume of 8% solution of formaldehyde. Ciliates were counted under a light microscope. Bacteria were counted using
Thoma chambers. The DNA of hyper ammonia producing
bacteria was isolated according to protocol of Bacterial
Genomic DNA Kit (Sigma). The presence of specific bacteria (Clostridium aminophilum, Bacteroides ruminicola) was
determined by PCR. The sequences of primers used and
the sizes of the expected PCR fragments are as follows:
Clostridium aminophilum cpn60F: 5’TGAAGAAGGCTACCGATGCT3’, cpn60R: 5’TTGGAAACCTTCTCCATTGC3’
165 bp; Bacteroides ruminicoloa proCF: 5’TCGATCGTGGTTACCTGTCA3’, proCR: 5’ATCAACATCCTCGGCGATTA3’ 188 bp. Primers were used for amplification of chaperonin (cpn60) and proC gene. The PCR reaction mixture
(25 μl) contained 1x buffer, 0.4 mM dNTP, 0.01 mM of
each primers and 1.5 U of polymerase. Amplification of
DNA followed by 30 cycles of denaturation (92oC 30s),
annealing (58.1oC 30s) and extension (72oC 1 min). The
PCR products were run on 1.5% gels containing 0.5 μg/
ml ethidium bromide and photographed.
The obtained data (separately for each experiment) were
subjected to variance analysis using the general linear
model (GLM) SAS procedure [12]. Multiple comparisons
among means were carried out by Duncan’s test. Significance was declared at P<0.05.
Results and discussion: Calsamiglia et al. [13] in his review of the in vitro, in situ, and continuous culture based
literature concluded, among others, that essential oils rich
in SPM: 1. may inhibit the deamination and methanogenesis resulting in lower ammonia, methane and acetate
concentration, higher propionate concentrations; 2. give
variable responses depending on the specific essential
oils (with specific SPM) combination. The effect of eugenol and vanillin supplemented separately to standard
in vitro diet are presented in Tables 1 and 2. Rumen pH
and ammonia values did not differ by secondary plant
metabolites supplementation, however the tendency to
ammonia decrease was observed when 40 mg of eugenol
was supplemented to the diet. The SPM used did not
inhibited the deamination of AA to ammonia. PCR reactions confirmed presence of Clostridium aminophilum and
Bacteroides ruminicola in all groups, nevertheless of type
and level of SPM used (Figs. 1 and 2). Further research
with FISH technique is needed to evaluate changes in
HAP quantity as an effect of SPM supplementation. It
is believed that most essential oils with SPM exert their
antimicrobial activities by interacting with process associated with the bacterial cell membrane, including electron transport, ion gradients, protein translocation, phosphorylation, and other enzyme-dependent reactions [2].
Eugenol and vanillin were not active against total bacteria count, however 400 mg of each particular SPM caused
Figure 1. Agarose gel electrophoresis of PCR-amplified products specific for Bacteroides ruminicola.
58
Abstracts 2009
Table 1. Effect of eugenol on ammonia and methane production, volatile fatty acids and microbial populations in Rusitec system
pH
N-NH3 [mmol/l]
Bacteria [107 ml-1]
Entodiniomorpha [103ml-1]
Holotricha [103 ml-1]
Methane [mmol/d]
Total VFA* [mmol/l]
VFA [mmol/l]
acetic
propionic
Eugenol supplementation
Control
4 mg
mean
SD**
mean
6.82
0.11
6.76
13.39
2.88
14.82
22.65
4.35
20.85
a
5.69
2.17
4.53a
a
5.27
6.20
4.07ab
3.27
1.74
2.34
72.90a
7.50
78.82a
b
34.38
2.73
40.07a
12.78a
3.22
12.12a
SD**
0.09
1.99
4.18
2.67
4.55
1.24
5.86
3.48
3.30
40 mg
mean
6.79
12.90
21.20
3.73a
3.66ab
2.97
73.28a
34.55b
11.31a
SD**
0.075
3.61
5.35
3.59
4.93
2.03
10.11
5.59
3.06
400 mg
mean
6.83
16.62
23.65
0.19b
0.34b
3.25
56.76b
24.05c
4.78b
SD**
0.09
3.39
4.35
0.38
0.64
1.69
9.44
4.48
1.11
*Volatile fatty acids; means with the same letter are not significantly different a,b,c
Table 2. Effect of vanillin on ammonia and methane production, volatile fatty acids and microbial populations in Rusitec system
pH
N-NH3 [mmol/l]
Bacteria [107 ml-1]
Entodiniomorpha [103ml-1]
Holotricha [103 ml-1]
Methane [mmol/d]
Total VFA* [mmol/l]
VFA [mmol/l]
acetic
propionic
Vanillin supplementation
Control
4 mg
mean
SD**
mean
6.70
0.12
6.63
17.57
3.15
20.39
46.71
9.27
41.22
9.18
6.96
5.21
0.19
0.58
0.19
4.10
1.31
4.75
ab
90.58
13.24
104.27a
ab
44.84
6.78
51.32a
16.57
2.79
17.22
SD**
0.24
8.23
10.46
3.00
0.58
1.31
25.29
12.08
4.96
40 mg
mean
6.70
18.24
48.21
7.96
0.3
3.54
85.67b
43.00b
14.88
SD**
0.10
2.63
8.17
4.95
1.16
2.03
5.26
3.27
2.15
400 mg
mean
6.74
18.57
44.18
3.62
0.00
3.77
81.93b
38.88b
13.70
SD**
0.14
4.14
9.84
2.22
0.00
1.20
7.49
3.27
2.63
- P<0.05; ** Standard Deviation
Figure 2. Agarose gel electrophoresis of PCR-amplified products specific for Clostridium aminophilum.
almost total protozoa defaunation. Supplementation of
ruminant diets with secondary plant metabolites may
alter rumen methane production by e.g. changes in the
diversity of rumen methanogens. No statistically significant changes were observed in our experiments, however
general tendency (except for group with 4% vanillin supplementation) for decreasing methane production was
stated. Total VFA concentrations were affected by treatments the lowest was observed in experimental group receiving 400 mg of eugenol in comparison to all three other
groups, whereas the highest concentration was stated for
group receiving 4 mg of vanillin supplementation. The respected results of eugenol and vanillin were not achieved.
We suggest that individual components of essential oils
are less active. Our results confirmed the hypothesis of
Benchaar et al., [2] suggesting that general antimicrobial
activity of essential oils is the result of synergistic effects
between individual components contained.
References:
1. Greathead H (2003) Proc Nutr Soc 63: 279-290.
2. Benchaar C et al (2008) Anim Feed Sci Technol 145: 209-228.
3. Tassoul MD, Shaker RD (2009) J Dairy Sci 92: 1734-1740.
4. Cardozo PW et al (2005) J Anim Sci 83: 2572-2579.
5. Russell JB et al (1991) Physiological aspects of digestion and metabolism in ruminants Academic Press, Tokyo, Japan pp 681-697.
6. McIntosh FM et al (2003) Appl Environ Microbiol 69: 5011-5014.
7. Nagaraja TG et al (1997) Ruminal Microbial Ecosystem Blackie
Academic & Professional, London pp 523-632.
8. Agrawal N et al (2009) Anim Feed Sci Technol 148: 321-327.
9. Czerkawski JW, Beckenridge G (1977) Br J Nutr 38: 317-384.
10. Szumacher-Strabel M et al (2002) J Anim Feed Sci 11: 577-587.
11. Tangerman A, Nagengast FM (1996) Anal Biochem 236: 1-8.
12. SAS (2006) SAS Institute Inc Cary, NC, USA.
13. Calsamiglia S et al (2007) J Dairy Sci 90: 2580-2595.
Acknowledgements:
This work was supported by the Ministry of Science and Higher
Education, project No N311 038 32/2587.
Vol. 56 Bioactive
Plant
Compounds
3.11
Limonene affect rumen methanogenesis
inhibiting the methanogens population
Adam Cieślak, Paweł Zmora, Agnieszka
Nowakowska, Małgorzata Szumacher-Strabel
e-mail: Adam Cieślak <[email protected]>
Essential oils (EO) are blends of secondary metabolites
derived from plant materials. Limonene, a hydrocarbon
classified as a cyclic terpene, is the main compound of
fir oil (Abies alba). Terpenoids are the most active compounds of essential oils (EO) and are attributed to have
antimicrobial properties acting, among others, against
archaeal communities. Methanogens, responsible for rumen methanogenesis, belong to the kingdom Euryarchaeota in the domain Archaea and are typified by their ability
to produce methane under anaerobic conditions [1]. Process of methanogenesis is detrimental either for ruminants
or to environment. Inhibition of ruminal methanogenesis
as the result of dietary supplementation of essential oils
rich in secondary plant metabolites (SPM) was broadly
discussed by Busquet et al. [2]. According to Ohene-Adjei et al. [1] it has become imperative that as scientists investigate the functional properties of feed additives, the
environmental impact of the choices made are not overlooked. However, effects of SPM present in essential oils
on methane production are not yet clear [3]. Some data
proved potentially antimicrobial properties of secondary
plant metabolites present in EO against a wide range of
rumen microorganisms and hence rumen microbial fermentation. Effect of active components of essential oils
depends on the chemical structure and constituents [4].
However, data on effects of secondary plant metabolites
on methane emission are still unexplored area. The objective of the present study was to evaluate the effects of
different doses of limonene on methane production and
ruminal methanogenesis in vitro.
Material and methods: The four fermenter Rusitec (Rumen Simulation Technique) with rumen fluid from cattle
was used as an in vitro system. The basal diet consisted
of forage (meadow hay, corn silage, alfalfa silage) and
concentrate (60:40). Average daily feed supply was 11 g
of dry matter (DM). The concentrate comprised wheat
(30%), corn (40%), rapeseed meal (24%) and a mineralvitamin premix (6%). In relation to the basal diet the content of the mineral-vitamin premix was 2%. Basal diets
were supplemented with 4, 40 and 400 mg of limonene
59
(4-izopropenylo-1-metylocykloheksen;
Sigma-Aldrich
Chemical) per L of rumen fluid. Two experimental runs
of 10 days each were carried out: the first 5 days served as
an adaptation period followed by 5 days measurements.
Each sample of experimental diets was incubated for 48 h.
To monitor the anaerobic conditions samples of fermenter fluid were analysed daily for pH and redox potential
with the respective electrodes connected to a pH-meter
(inoLab 713, Poland). Counts of ciliate protozoa and bacteria were obtained daily with Bürker and Thoma chambers: 0.01 and 0.02 mm depth, respectively (Blau Brand,
Wertheim, Germany). The fluorescence in situ hybridization (FISH), according to Stahl et al. [5] with modification
of Machmüller et al. [6] was performed to quantify the
methanogens. FISH is cytogenetic technique, which can
be used in identification and counting of bacteria. It uses
fluorescent probes that bind to only those parts of the
DNA with which they show a high degree of sequence
similarity. In experiment, specific oligonucleotide probe
(Tib-MolBiol, Poznan, Poland) was performed for all
methanogens (Archeae) S-S-GTGCTCCCCCGCCAATTCCT-a-A-20 [7], which was complementary to 16S rRNA.
Hybridization was performed at 37°C in hybridization
buffer containing 0.9 M NaCl, 20 mM Tris/HCl (pH 7.2),
38% formamide and 0.1% sodium dodecyl sulphate with
50 ng well-1 fluorescent dye Cy3 at the 5’ end The dyeing 4′,6-diamidino-2-phenilindol (DAPI) was used to corroborate that the observed fluorescence with the FISH
technique corresponded to bacteria cells. Fermentation
gases were collected daily and analysed for methane,
dioxide (gas chromatograph SRI model 310C; equipped
with thermal conductivity detector TCD) and gas volume was quantified by water displacement according to
Machmüller et al. [6]. The obtained data (separately for
each experiment) were subjected to variance analysis using the general linear model (GLM) procedure of SAS [8].
Multiple comparisons among means were carried out by
Duncan’s test. Significance was declared at P<0.05.
Results and discussion: Secondary plant metabolites as
a potential rumen fermentation modulators may change
the basic parameters of rumen fluids including pH, VFA
concentration and the number of bacteria and protozoa [9, 10]. On the other hand some study showed that
limonene and other monoterpene hydrocarbons only
slightly promoted or had no effect on the activity of rumen microorganisms in sheep and deers [11]. Concentration of 5 mg of limonene per liter of rumen fluid did not
modify rumen microbial fermentation in research carried
out by Castillejos et al. [12]. In our study no significant
differences between control pH and pH of groups supplemented with limonene were observed (pH ranged from
6.7 to 6.8). Limonene affected rumen microorganisms
count (Table 1), however only the highest tested level (400
Table 1. The effect of limonene supplementation on rumen microorganisms counts
Bacteria [107 ml-1]
Protozoa [103 ml-1]
Methanogens [%]**
Limonene supplementation
Control
4 mg
mean
SD*
mean
SD*
40 mg
mean
SD*
400 mg
mean
SD*
30.22a
5.31a
43.40a
4.80
1.62
8.85
25.70ab
4.92a
32.36b
5.49
3.31
11.75
24.00b
1.56b
32.66b
4.78
1.73
7.92
6.51
2.20
6.50
27.28ab
4.46a
37.58ab
means with the same letter are not significantly different a,b, - P<0.05; * Standard Deviation; ** -% of methanogens in all bacterial cells dyed with DAPI
60
Abstracts 2009
3.12
Chemical composition and antioxidant
activity of strawberry liqueurs
Anna Sokół-Łętowska1, Alicja Z.
Kucharska1, Antoni Szumny2
1Department
of Fruit and Vegetables Technology,
of Chemistry, University of Environmental and
Life Science, C.K. Norwida 25/27, 50-375 Wrocław, Poland
e-mail: Anna Sokół-Łętowska <anna.sokol-letowska@
up.wroc.pl>
2Department
Figure 1. The effect of limonene on ruminal methane production.
mg/L) resulted in 20% reduction of total rumen bacteria
and decreased of 70% protozoa population. Our results
are consistent with dose depending antibacterial activity
of essential oils rich in SPM, which was demonstrated by
Dorman and Deans [13]. The inhibiting effect of EO on
ruminal cilliates was also investigated by Min et al. [14].
Number and diversity of ruminal microbiota is connected with rumen methane production. Supplementation
of limonene affected methanogenesis. Reduced methane
production (by 26%, Fig. 1) and number of methanogens
(by 25%, Table 1) was stated when 40 mg/L of limonene
was added. No effect of secondary plant metabolite used
on dry matter digestibility was observed. Dry matter digestibility values ranged between 34.5 to 36.7%. Also Benchaar et al. [3] exploring the ground root of Rhubarbar as
dietary supplement observed the inhibition of methane
in vitro production by 20% without affecting digestibility.
Results of our study suggested that, not only as high as
400 mg/L dose of limonene may influence methanogenesis in the rumen. This dose inhibited the microorganisms
involved in methane production, like bacteria, protozoa
and methanogens but also the 40 mg/L dose of limonene
can reduce the methane production by directly mitigation
of total methanogens population. The hypothesis that effect of active components of essential oils depends on the
constituents was confirmed.
References:
1. Ohene-Adjei S et al (2008) Microb Ecol 56: 234-242.
2. Busquet M et al (2005) J Dairy Sci 88: 4393-4404.
3. Benchaar C et al (2008) Anim Feed Sci Technol 145: 209-228.
4. Śliwiński BJ et al (2002) Arch Anim Nutr 56: 379-392.
5. Stahl DA et al (1995) Archea: Methanogens: A Laboratory Manual,
New York, Cold Spring Harbor Laboratory Press, pp 111-121.
6. Machmüller A et al (2003) Br J Nutr 92: 689-700.
7. Lin C et al (1997) FEMS Microbiol Ecol 22: 281-294.
8. SAS (2006) SAS Institute Inc Cary, NC, USA.
9. Deans S, Ritchie G (1987) Int J Food Microbiol 5: 165-180.
10. Chao SC et al (2000) J Essent Oil Res 12: 639-649.
11. Oh HK et al (1967) Appl Microbiol 15: 777–784.
12. Castillejos L et al (2006) J Dairy Sci 89: 2649-2658.
13. Dorman H, Deans S (2000) J Appl Microbiol 88: 308–316.
14. Min BR et al (2000) Can J Microbiol 48: 911–921.
Acknowledgements:
This work was supported by the Ministry of Science and Higher
Education, project No N311 038 32/2587.
Strawberries are one of the most aromatic fruits. They
are widely consumed, both fresh and in processed forms,
such as juices, jams and others, among them liqueurs.
They present many specific healthy nutritional characteristics. Besides essential nutrients, strawberries contain
high levels of antioxidant compounds such as anthocyanins, flavonoids, and phenolic acids, especially ellagic
acid in the form of water-soluble ellagitannins. This phenolic compound is known as a naturally occurring dietary
antimutagen and anticarcinogen.
Flavor plays an important role in consumer satisfaction,
so aroma compounds influence liqueurs organoleptic
quality.
Alcoholic beverages are normally considered to be products with a long shelf life, but phenolics can be involved
in reactions leading to instability. Little information is
available regarding the effects of storage time on the
changes of phenolic compounds, and antioxidant capacity in strawberry liqueurs.
The aim of this work was to evaluate, how the method of
preparation and storage influenced antioxidant activity
and phenolic compounds of strawberry liqueurs.
Methods: The liqueurs were prepared in four variants:
with the use of ethanol of 45% and 65% v/v grade, and
with the addition of sugar on various stages of the product preparation (at the beginning and after 1 month of
ethanolic extraction).
Total phenolics (mg of gallic acid in 100 cm3) were determined according to the Folin–Ciocalteu method [1].
Scavenging activity of the liqueurs has been investigated
by using the TEAC (Trolox Equivalent Antioxidant Activity) assay against ABTS radicals [2] and by reducing
power (FRAP) [3]. The variability of these activities has
been monitored during the storage time.
Instrumental colour measurements of liqueurs were conducted with a Hunter Lab colour measurement system
(ColorQuest XE). L*, a*, b* values were used for evaluating liqueurs colour.
The separation of volatile compounds was performed by
using modification of typical distillation-extraction on
Deryng apparatus. Collected in organic phase (cyclohexane), volatiles were analyzed on GC-MS. Most of the
compounds was identified by using 3 different analytical methods: 1) Kovats indices, 2) GC-MS retention indices (authentic chemicals), and 3) mass spectra (authentic
chemicals and NIST05 spectral library collection).
Results and discussion: Strawberry liqueurs were good
source of phenolic compounds. Total phenolic content after 3 months of aging was from 74.4 to 103.1 mg GA/100
Vol. 56 Bioactive
Plant
Compounds
cm3. Heinonen et al. [4] determined the total phenolic contents in fruit wines and liqueurs at a level of 16.0–182.0
mg/100 cm3. In comparison, our liqueurs contained 91 to
104 mg of phenolics in 100 cm3 after 26 months of storage.
Nocino – traditional walnut liqueurs contained from 29 to
388 mg/100 cm3 [5]. It shows that liqueurs can be valuable
sources of phenolic compounds. The highest polyphenol
concentration was determined in liqueur prepared from
65% grade alcohol added with sugar simultaneously.
TEAC values measured against ABTS radical were from
777 to 854 μM TE/100 cm3, and reducing power – from
402 to 551 μM TE/100 cm3.
Antioxidant activity (ABTS and FRAP) was highly correlated with total phenolic compound content (correlation coefficient = 0.80–0.86) after 3 months of storage. The
amount of substances reacting with Folin-Ciocalteau solution increased about 20–40% and more, but antioxidant
activity decreased on average 15–20% during 26 months
of aging. Storage strongly affects the content of phenols
since they can undergo modifications during aging,
mainly due to hydrolysis, oxidations and complexations.
Hydrolysis is mainly responsible for the increase of simpler compounds, such as free phenolic acids [6, 7].
Anthocyanins are very poorly stable in the storage conditions. Therefore, the color of liqueurs changed from redorange into brownish (light brown). Stored samples had
higher L* and b* values and lower a* value than control
samples. The ratio a/b decreased with time.
More than 30 compounds, present in the liqueur were
identified. Apart from typical aliphatic esters, characteristic for strawberry flavor, we also found alkenyl terpenes
(b-pinene, limonene), aldehydes (furfural, benzaldehyde,
hexenal), ketones (carvone, verbenone), ethers (eucalyptol, linalool oxides). Interestingly, some of identified
compounds are characteristic also for honey flavors. Presented procedure of analysis of volatiles liqueurs is new
and we believe it could find application in rapid analysis
of aroma compounds in alcohols.
References:
1. Slinkart K, Singleton V L (1977) Am J Enol Vitic 28: 49-55.
2. Re R et al (1999) Free Radic Biol Med 26: 1231-1237.
3. Benzie I F, Strain JJ (1996) Anal Biochem 239: 70-76.
4. Heinonen I M et al (1998) J Agric Food Chem 46: 4107-4112.
5. Alamprese C et al (2005) Food Chem 90: 495-502.
6. Montoro P et al (2006) J Pharm Biomed Anal 41: 1614-1619.
7. Zafrilla P et al (2003) J Agri Food Chem 51: 4694-4700.
61

3.1 Session 3. Application of natural products in human and ani

Transkrypt

Podobne dokumenty

EFFECT OF BEES-POLLINATORS IN BUCKWHEAT

Lectures L7.1 Session 7. Protein Transport and Assembly

tannins from sanguisorba officinalis affect in vitro rumen methane

Selected foreign plants in old Polish botanical literature, customs Acorus calamus Fagopyrum

Session 3. Proteins — Structure and Function Lectures L3.1 L3.2

Structural Relationships Among the Ribosomal Stalk Proteins from